홈 > 미생물 검색

미생물 검색

먼저 검색하실 미생물 분류를 선택하신 후 검색 항목을 지정하여 검색하시기 바랍니다.

도움말
미생물 검색 리스트
미생물명 Saccharomyces cerevisiae CLASS BACTERIA
Vial Name MC4-37

▷ History

Source : 충무멸치젓 / Medium : TSB / Final OD : 6.67 / ProteinBSA(㎎/㎖) : 1.22 / Protease : -1.37 / Pro. 편차 : 0.06

β-amylase : -0.44 / β-A 편차 : 0.08 / Cellulase : 0.70 / Cellulase 편차 : 0.21 / Pectinase : 1.37 / Pectinase 편차 : 0.41

ACE inhibitory activity : 86.60 / ACE 편차 : 0.20 / XOD inhibitory activity : n.d / XOD 편차 :

SOD-like activity(%) : n.d / Antioxidant activity(%) : 9.90 / Antioxidant 편차 : 0.50 / a-Glucosidase inhibitory activity(%) : n.d

Tyrosinase inhibitory activity(%) : 20.80 / Tyrosinase 편차 : 0.10 / Fibrinolytic activity(mm) : 0.10


▷ Sequence

"TACGTGCAGGTCTAAAGTATAGCATTTATACAGTGAAACTGCGAATGGCT
CATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACATGGTATAA
CTGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAA
GAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGAT
TCATAATAACTTTTCGAATCGCATGGCCTTGTGCTGGCGATGGTTCATTC
AAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGT
TTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAG
AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC
CTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGG
TCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTG
GAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGT
ATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGG
TTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCT
TCTGGCTAACCTTGAGTCCTTGTGGCTCTTGGCGAACCAGGACTTTTACT
TTGAAAAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAATATATTAGC
ATGGAATAATAGAATAGGACGTTTGGTTCTATTTTGTTGGTTTCTAGGAC
CATCGTAATGATTAATAGGGACGGTCGGGGGCATCAGTATTCAATTGTCA
GAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTGG
CCAAGGACGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGATGA
TCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGATCGGGG
GGGGTGTTTTTTTAATGACCCACTCGGCACCTTACGAGAAATCAAAGTCT
TTGGGTTCTGGGGGGGAATATGGTCGCAAGGCTGAAACTTAAAGGAATTG
ACGGAAGGGACCCCCCCGGAGTGGAACCTGCGGCTTATTTTACTCAACCC
GGGGAAACTCCCCAGGCCCAACCCATAAGGATTGACAAATTGGAGCTCTT
TTTGATTTTTTGGGGGGGGGTGCAGGGCCCTCTTTTTTTTGGGGAGGATT
TTTCTTCTTATATGTTAAACAAAAAGACCTTACCCTCAAAAAAGGTGCCG
CCTTTTCTGGTTACCCTTCTTAAGGAGAATCTTTTTATCCCAGAGAATTG
TGAGAAACAAGCCGGTTGCGCTTTAAATATTTGGCCGCGCGCCCACCACA
GAAGCGGAAAAATTTCCCAGAAAGTGAGTATTGGTATTACTTCCGGGCGG
GAGGGTGGATTGTTTTTAAAATTATAAAAACAAATTTCATTTATACCTCT
CTCCCCCCGCTCCCCAAGGTGTACGGGACTTCAAGGAACGACATAAAGGT
TAAGATAACTTAGGACGGAGTTGCCCCTTTTTTTGGGGA
"



▷ NCBI sequence Analysis : Gene Bank Accession No. GQ458028.1 / NCBI Name Staphyloco / Identity 96

▷ 배양온도 : 30℃

▷ 가격코드 : 55,000원

▷ AM : 5

목록

분양신청 Print