홈 > 미생물 검색

미생물 검색

먼저 검색하실 미생물 분류를 선택하신 후 검색 항목을 지정하여 검색하시기 바랍니다.

도움말
미생물 검색 리스트
미생물명 Leuconostoc mesenteroides CLASS BACTERIA
Vial Name 61513

▷ History

Source : 순무물김치 / Medium : MRS / Final OD : 0.12 / ProteinBSA(㎎/㎖) : 1.63 / Protease : -1.68 / Pro. 편차 : 0.42

β-amylase : -0.74 / β-A 편차 : 0.06 / Cellulase : 17.71 / Cellulase 편차 : 0.11 / Pectinase : -2.49 / Pectinase 편차 : 0.41

ACE inhibitory activity : 73.70 / ACE 편차 : 0.20 / XOD inhibitory activity : 1.40 / XOD 편차 : 0.50

SOD-like activity(%) : n.d / Antioxidant activity(%) : 14.70 / Antioxidant 편차 : 0.10 / a-Glucosidase inhibitory activity(%) : n.d

Tyrosinase inhibitory activity(%) : 12.90 / Tyrosinase 편차 : 0.20 / Fibrinolytic activity(mm) : n.d


▷ Sequence

"AGGAGGGTGCGGCGTTGCTATACTGCAAGTCGAACGCACAGCGAAAGGTG
CTTGCACCTTTCAAGTGAGTGGCGAACGGGTGAGTAACACGTGGACAACC
TGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGAATAA
AACTTAGTGTCGCATGACACAAAGTTAAAAGGCGCTTCGGCGTCACCTAG
AGATGGATCCGCGGTGCATTAGTTAGTTGGTGGGGTAAAGGCCTACCAAG
ACAATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGA
GACACGGCCCAAACTCCTACGGGAGGCTGCAGTAGGGAATCTTCCACAAT
GGGCGAAAGCCTGATGGAGCAACGCCGCGTGTGTGATGAAGGCTTTCGGG
TCGTAAAGCACTGTTGTATGGGAAGAACAGCTAGAATAGGAAATGATTTT
AGTTTGACGGTACCATACCAGAAAGGGACGGCTAAATACGTGCCAGCAGC
CGCGGTAATACGTATGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAG
CGAGCGCAGACGGTTTATTAAGTCTGATGTGAAAGCCCGGAGCTCAACTC
CGGAATGGCATTGGAAACTGGTTAACTTGAGTGCAGTAGAGGTAAGTGGA
ACTCCATGTGTAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGTGG
CGAAGGCGGCTTACTGGACTGCAACTGACGTTGAGGCTCGAAAGTGTGGG
TAGCAAACAGGATTAGATACCCTGGTAGTCCACACCGTAAACGATGAACA
CTAGGTGGTTAGGAGGTTTCCGCCTCTTAGTGCCGAAGCTAACGCATTAA
GTGTTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATTGA
CGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCG
AAGAACCTTACCAGGTCTTGACATCCTTTGAAGCTTTAGAAGATAGAAGT
GTTCTCTTCGGAGACAAAGTGACAGGTGGTGCATGGTCGTCGTCAGCTCG
TGTCGTGAGATGTTTGGGTTAAGTCCCGCAACGAGCGCAACCTTTATTGT
TAGTTGCCAGCATTCAGATGGGCACTCCTACCGAGACTGCCCGTGACAAA
CCGGAAGAAAGGCGGGGACAAAGTCGGATCATCATGCCCCTTATGACCGG
GGCTACCAACTTGCTACAATGGCGTATACAACGAGTTGCCACCCCGCCAA
GTTGACCTAACTCTTTAAAGGACGTCTCAATTTCCGATTTGAGTCTGGCA
CTCCAACAACTTGAATCCGGAATCCCTTGTAATCCCGAATAACAAACCCC
CCGTGAAAAAATTTCCCCGGTTTTGGAACACCCCCGTTCCCACCGGGGGA
TTTGTATGCCCAAACCCGGCCCACCTTTTGAAAGGCCTTAGGCGATCGGG
TTTGGTTGTTTTGGGGAGCCTAAGTCGGGGCCGGGGGGGGGGGGGAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAGGGGGGGAAAAGGGGGGGGGGGGAGGAAGAAAAGGAAGAAAAGGGAG
GGGGGGGAGGAAAAGGGGAAAGAGGGGGGGGAGGAGAGGGAGAGAGAAGG
GGGGG
"



▷ NCBI sequence Analysis : Gene Bank Accession No. GQ280807.1 / NCBI Name Leuconosto / Identity 95

▷ 배양온도 : 30℃

▷ 가격코드 : 55,000원

▷ AM : 5

목록

분양신청 Print