홈 > 미생물 검색

미생물 검색

먼저 검색하실 미생물 분류를 선택하신 후 검색 항목을 지정하여 검색하시기 바랍니다.

도움말
미생물 검색 리스트
미생물명 Uncultured bacterium CLASS BACTERIA
Vial Name 62315

▷ History

Source : 깻잎김치 / Medium : MRS / Final OD : 0.40 / ProteinBSA(㎎/㎖) : 2.01 / Protease : -1.42 / Pro. 편차 : 0.68

β-amylase : -0.25 / β-A 편차 : 0.01 / Cellulase : -8.45 / Cellulase 편차 : 0.00 / Pectinase : 7.95 / Pectinase 편차 : 0.00

ACE inhibitory activity : 60.50 / ACE 편차 : 0.40 / XOD inhibitory activity : 2.80 / XOD 편차 : 0.40

SOD-like activity(%) : n.d / Antioxidant activity(%) : 23.40 / Antioxidant 편차 : 0.30 / a-Glucosidase inhibitory activity(%) : n.d

Tyrosinase inhibitory activity(%) : 7.70 / Tyrosinase 편차 : 0.30 / Fibrinolytic activity(mm) : n.d


▷ Sequence

"GACATGGCGCGTGCCTATACATGCAGTCGAACGCTTTGTGCTTAATTGAT
ATGACGAGCTTGCTCTGATTTGATTTTTTGATTTCAAAGAGTGGCGAACG
GGTGAGTAACACGTGGGTAACCTACCTCTTAGCAGGGGATAACATTTGGA
AACAAGTGCTAATACCGTATAATACCAACAACCGCATGGTTGTTGGTTGA
AAGATGGTTCTGCTATCACTAAGAGATGGACCCGCGGTGCATTAGCTAGT
TGGTAAGGTAATGGCTTACCAAGGCAATGATGCATAGCCGAGTTGAGAGA
CTGATCGGCCACAATGGGACTGAGACACGGCCCATACTCCTACGGGAGGC
AGCAGTAGGGAATCTTCCACAATGGGCGCAAGCCTGATGGAGCAACGCCG
CGTGTGTGATGAAGGGTTTCGGCTCGTAAAACACTGTTATAAGAGAAGAA
CGGCACTGAGAGTAACTGTTCAGTGTGTGACGGTATCTTACCAGAAAGGA
ACGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGTTCCAAGCGTT
ATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGTCTGA
AGTGAAAGCCCTCAGCTCAACTGAGGAATTGCTTTGGAAACTGGATGACT
TGAGTGCAGTAGAGGAAAGTGGAACTCCATGTGTAGCGGTGAAATGCGTA
GATATATGGAAGAACACCAGTGGCGAAGGCGGCTTTCTGGACTGTAACTG
ACGTTGAGGCTCGAAAGTGTGGGTAGCAAACAGGATTAGATACCCTGGTA
GTCCACACCGTAAACGATGAGTGCTAGATGTTCGAGGGTTTCCGCCCTTG
AGTGTCGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAA
GGTTGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATG
TGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAGGTCTTGACATCCCT
TGACAACGCTAGAAATAGCGCGTTCCCTTCGGGGACAAGGTGACAGGTGG
TGCATGGTTGTCGTCAGCTCGTGTCCTGAAAATGTTGGGTTAAGTCCCGC
AACCAACGCCAACCCTTATTATTAATTGCCAGCATTCATTTGGGCCCTCT
ATTGAGACTGCCCGTGAAGACCCGAGAAAAATTTGGGATGAAGTCAAATC
TTCATGCCCCTTATAACCTGGGGTACCCACGTGGTTCAATTGGCAATAAC
AACAAATCCCTAACCCGCCGAGGTGGCCTTATTCCTTAAGGAGGGTTCAT
TTTCAATTTGAGGCCGCACTCCCGCCCTGGAGTCGGAACCCTTTTAATCC
GGATCAAAACCCCCCGGGAAAAATTCCGGGGTCTGGCACCCCGCCCTCCC
CCGGCAGTTGTGACCCAAACCAAGGGGAACTTAAGACCCCTTAGGGATTA
GGTTTTGTTGGAGCGAGGCGGGGCCGGGGAAGAGGGACGGGGAAAAAGGG
AAAACAAGAAAAAAAGGAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGTAA
AAAGGGGGGGGGGAAAGGGGAGAAAGGGGGGAGGGGGGGGGAAAAAGGAG
GGTAGGGGGAGAAAAAGGGGGAGGAAAGGGGGAAGAAAAAGGGGGAAAAA
AGGGGGGGAAGGGGG
"



▷ NCBI sequence Analysis : Gene Bank Accession No. HM847081.1 / NCBI Name Weissella / Identity 95

▷ 배양온도 : 30℃

▷ 가격코드 : 55,000원

▷ AM : 5

목록

분양신청 Print