홈 > 미생물 검색

미생물 검색

먼저 검색하실 미생물 분류를 선택하신 후 검색 항목을 지정하여 검색하시기 바랍니다.

도움말
미생물 검색 리스트
미생물명 Leuconostoc citreum CLASS BACTERIA
Vial Name 73911

▷ History

Source : 민들레김치 / Medium : MRS / Final OD : 0.58 / ProteinBSA(㎎/㎖) : 2.01 / Protease : -1.20 / Pro. 편차 : 0.06

β-amylase : -0.66 / β-A 편차 : 0.30 / Cellulase : -15.18 / Cellulase 편차 : 0.00 / Pectinase : -2.82 / Pectinase 편차 : 0.00

ACE inhibitory activity : 64.10 / ACE 편차 : 0.30 / XOD inhibitory activity : n.d / XOD 편차 :

SOD-like activity(%) : n.d / Antioxidant activity(%) : 16.40 / Antioxidant 편차 : 0.50 / a-Glucosidase inhibitory activity(%) : n.d

Tyrosinase inhibitory activity(%) : 12.30 / Tyrosinase 편차 : 0.10 / Fibrinolytic activity(mm) : 13.10


▷ Sequence

"AAAGGGCGAATGGTATCATCGAGTCTGATCATGGCACGCGAATCGTGAGG
AGGTTGCACCTAATCAGCGAGTGGTGAACGGGTGAGTAACTCGTGGATAA
CCTGCCTCAAGGCTGGGGATAACATTTCGGAAACAGATGCTAATACCGAA
TAAAACTTAGTATCGCATGATATAAAGTTAAAAGGCGCTACGGCGTCACC
TAGAGATGGATCCGCGGTGCATTAGTTAGTTGGTGGGGTAAAGGCTTACC
AAGACAATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACATTGGGAC
TGAGACACGGCCCAAACTCAAACGGGAGGCTGCAGTAGGGAATCTTCCAC
AATGGGCGCAAGCCTGATGGAGCAACGCCGCGTGTGTGATGAAGGCTTTC
GGGTCGTAAAGCACTGTTGTATGGGAAGAAATGCTAAAATAGGGAATGAT
TTTAGTTTGACGGTACCATACCAGAAAGGGACGGCTAAATACGTGCCAGC
AGCCGCGGTAATACGTATGTCCCGAGCGTTATCCGGATTTATTGGGCGTA
AAGCGAGCGCAGACGGTTGATTAAGTCTGATGTGAAAGCCCGGAGCTCAA
CTCCGGAATGGCATTGGAAACTGGTTAACTTGAGTGTTGTAGAGGTAAGT
GGAACTCCATGTGTAGCGGTGGAATGCGTAGATATATGGAAGAACACCAG
TGGCGAAGGCGGCTTACTGGACAACAACTGACGTTGAGGCTCGAAAGTGT
GGGTAGCAAACAGGATTAGATACCCTGGTAGTCCACACCGTAAACGATGA
ATACTAGGTGTTAGGAGGTTTCCGCCTCTTAGTGCCGAAGCTAACGCATT
AAGTATTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCCAAAGGAAT
TGACGGGACCCCACAAGCGGTGGACATGTGGTTAATTCGAAGCACGCGAA
GACCTAACAGGCTTGACTCCTTGAACTTTAGAGTAGAGTGTCTCTTCGAG
ACAAGTGAAGGGGTGCATGTCGTCTCACTCGTGCCTGAATGTTGGTTAGT
CCGCACGACGCACCTTATGTAGTGCAGCATCAGTGGGCCTCAGCGAGATG
CGGGACAACCGAAGAAGCGGGACACGCGAACACATGCCCTTAGACT
"



▷ NCBI sequence Analysis : Gene Bank Accession No. AB572028.1 / NCBI Name Leuconosto / Identity 94

▷ 배양온도 : 30℃

▷ 가격코드 : 55,000원

▷ AM : 5

목록

분양신청 Print